Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig15
Contig Information
Length 595 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl5d07    rwhfl5d07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 198
Evalue 5.82886e-14
Total Hit Count 56
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig15
accaccactcccaCCACTTCGAGCGCCTCCTCCTGTCTCGTCCTCGTCCCCCGTCCCCCGTCCCCTCGTCGGCGCCCGATCTAAGTCAAGATGAGTCGTG
GCGGGAGTGCTGGAGGTGGTCAAAGTTCTCTGGGTTACCTGTTTGGAGATGGTGAGCCTGCAAAGCCTGCTGCAGCACCAGCTGCGAAGCCAGCACCTGC
TGAGAAACCAGCACTGGCAGCTGCCGATGTAACCAAGCAGATTCCAGCTGGCATTCCAGGTAGCCGGGCGAACAACTACTACCGTGCAGATGGCCAGAAC
ACGGGCAACTTCCTTACGGACCGTCCTTCAACCAAGGTTCATGCTGCTCCCGGCGGTGGCTCGTCCCTGGGCTACTTGTTTGGCGGGAAGTGATCTCTGT
TAATGATGCTGCGATGAATTGGCCTGTATCTCTGTTATCCATGTGGTGAAAACTGGAAGTGTTTGGTTTcagcaGTTTACCACCTGCGTCGATGTACTCT
GTCtgtatggttcattgtgtccaggctgacctcctgcttggaagccagcttgcctaaaacctgtcgctttcaaactaatcgtcttcatctcaaaa
page-top