Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig2136
Contig Information
Length 846 bp
Tissue Dormant seed with water absorption after breaking
Clones 14 Clones [Download: CSV  ,  FASTA ]
whei1l09    whei3l01    whei4f02    whei7d09    whei10e08    whei18d15    rwhei1l09    rwhei1l10    rwhei3l01    rwhei4f02    rwhei7b11    rwhei7d09    rwhei17g15    rwhei18d15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L15 [Homo sapiens]
Score 856
Evalue 6.04126e-90
Total Hit Count 402
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig2136
TTTTTTTTTTGACAGCATAGCACACAGCATACGATTACTAAACCATTCTTTCTTCTGGTAACACAGGCAGATAGCAAATAGTTCAACAGATATGCCTCGA
CATAAAGGTTCTAGCACAAGCTTCAAGTAGTCTCAGAACGAAGGTAGCAAAACCTGATGGCTCAAACAAAATACTATCAAGGTGTGCATAGGGCAGCTTA
ACGGTAGCGGCGGAGGGAGACGGTCTGGTTGCGCTTCCAGGTGGCTCTCCTTGAGGGCCTGTTCTTGTGGTGGCGGTGGCCCTTGCCACGCAGACCACGG
AATTTCTTTCCCGCCGACGTGAGTCCGCGAAGCTCACGGTGCTTGTGCACGGGCTTGCAGAGCCAGTTGATCCTTGGGTCGTTGCGGACAGCACTGTGAG
CAACATCAACAAGGATGACCTCAAAGTACTTGTAGGTAGAGTCCTCATTCACCCAGTAGGAGTTGAGCACACGAAGACCACCCAGCCTGCGCCCAGCTCT
TTCTTCAGCAACAGACCTCTTGTTCCTCTGGAACTTGAGCTGGGTAATACCCTGGTGCTTGGGCTTACCATAGACAATACCCTTGGGCACTGGCCTCTTC
CTGCCACCACGCCTGACACGGATACGGTAGACCACATACCCCTGCTTGGCCTTGAAGCCGAGACGGCGAGCCCTGTCGGGGCGGGTGGGCCTGGTGATGC
GCACGATGGCCGGCTGCTGCCTGTACTCCCAGCAACGCACGCGCTGCACGAACCTCATCACGTCCGACTGCTTCCTCCTCCATAGCTCCGACACGAACTT
GTACGCGCCCATGGCTGCGGCTGCGGCTGCGGCGGCAGAGTGCGAG
page-top