Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig2120
Contig Information
Length 1186 bp
Tissue Dormant seed with water absorption after breaking
Clones 13 Clones [Download: CSV  ,  FASTA ]
whei3i13    whei14f15    whei18o16    whei19o15    whei20i21    whei20i22    rwhei3i13    rwhei6i06    rwhei14f15    rwhei18o16    rwhei19o15    rwhei20i21    rwhei20i22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1202
Evalue 7.8197e-130
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig2120
AAGCCAACTTATAACACAAACTTTCAGTCTCCCTCTCCCTCATCACGATGTCGATAGCAGAGATCACAAATTCATCTAGAAAATCCTAAAACACAGGTTT
TTGTCCATAGGGTAGATATAGCAGATCGCATCAGATGCTAGATATCCATTAATGCCTCACAAAATATGAACTTTAAGCCACAAAGACATCTCAAGGGAGC
ATCCTAGTCTACTCCCAGCCTTGAGCAGGGGGTTGCACCGCGGCGTCCCAGCCAGTAGCAGCCACAACAGGAGCAGGGACAGCACCTTCCACAGCAACAG
GTGCCCCTGCTGCATCCCATCCATCACCACCAGCAACTGGAGCTTCAGCCATCGGCCACTCGCCACCAGTAACAGGCGGGGGAGCAGGTGCGTCAGAGGT
CCACTGGTCACCACCCCATTGACCAGCTGCAGCTCCGTAATCAGTGATGGCAGCATACTCTGGGGCTCCAGCAGCTTCATCCTCCTGCTCCTTGGCTTCC
TCAGGGTCCCTGTAGAAGAACAGATCAACCATGACATCCCACTTGTGCCCTGGCAGGATAGTACCCCTCATCTGCAGAACCATCCTGGCCAAGAGCCAGT
ACAGGCAGCCAATGCTGTTCCTCCCCTTGTTGTTTGCTGGGATGCCGATATCGACGTATCGCATGGGAGAGTCAGTGTCACAGAAGGCAATGGTAGGGAT
GTTCCCCAGAGCAGACTCCTTGATGGGCTGGTGGTCAGTCCTTGGGTCGGTGAGGATGAGCAGGCGGGGCTCGCTGAAGGAGGTCTGCATCTGGTTGGTG
AAGGTTCCAGGGGTGTGCCTCCCGGCGATGGCGTTGGCGCCTGTGTGCTGCGCGAACTTGAGGACGGCGCGTTGGCCGTAGGGGCGGGCGGACTGGACGA
TGATGTCCTGGGGGTTCTCGATGGCGACGATAACCCTCGCCGCGAGCTGGAGCTTCTCCCATGTCTTGCCCAGATTGATGATGTAGATGCCGTCGGAGCG
GCGCTTGTAGGCGTAGCGCTCCATCTGGAAGTCGCAGTTCTTGGTGCCGAGGTGGACGTCGGCGGCGAGCATCATCTGTATGTCCTGCTCCTTCTGGGAC
AGCGCCCGCGGGGCCTCTCCAGCCGCTGCCGCCATGGTTGGTCGGGGACTCGAGCGTCCGGGGGGCGCCGCGAAGGGGAGGAGGAG
page-top