Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig2040
Contig Information
Length 867 bp
Tissue Dormant seed with water absorption after breaking
Clones 9 Clones [Download: CSV  ,  FASTA ]
whei10j06    whei11b16    whei12p06    whei17h16    whei18a19    rwhei11b16    rwhei12p06    rwhei17h16    rwhei18a19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12360 [Oryza sativa Indica Group]
Score 675
Evalue 6.12754e-69
Total Hit Count 398
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig2040
AGAGCGGCGGCGAAGATGGTGTCGCTGAAGCTGCAGAAGCGCCTGGCCTCGAGCGTCCTCAAGTGCGGCAAGGGCAAGGTCTGGCTCGACCCCAATGAGG
TCAACGAGATCTCCATGGCCAACTCCCGGCAGAACATCCGGAAGCTGGTAAAGGATGGTTTCATCATCAGGAAGCCTCAGAAGATCCACTCCAGGTCTCG
TGCAAGGAGGGCACATGAGGCCAAGCAGAAGGGCCGTCACTCTGGATATGGTAAGCGTAGGGGTACCAGGGAGGCTAGGCTCCCCACCAAGATCCTGTGG
ATGCGGAGGATGCGCGTCCTGAGGCGCCTTCTGCGCAAGTACCGTGAGGCCAAGAAGATCGACAAGCACATGTACCATGACATGTACCTGAAGGTCAAGG
GTAACATGTTCAAGAACAAGAGGGTCCTCATGGAGAGTATCCACAAGTCCAAGGCTGAGAAGGCAAGAGAGAAGACCCTCTCTGATCAGTTTGAGGCCAA
GCGCGCCAAGAGCAAGGCAAGCAGGGAGAGGAAGCATGCCAGGAGGGAGGAGAGATTGGCTCAGGGCCCCAGAGATCATGCACCAGCACCAGCGGCTGCA
GCTCCAGCTCCAGCTCCGGCAGCAGCGGCACCAAAGAAGGCCAAGGCCAAGAAGTGAAGGTCTGACATGAAGCTTTAGCTTTCTGGTATCATGAAGGGTT
AGCCTGATTTTGGAGCATCTGAAGTTCAGAACTGTTTTCTGTGCAATATCTGTGTGCCGCGTATGAGATACCTTAAATATCATATCGTGTTTGTTCTGTT
GGATGTTGCTTATGCAGAGTTTCTTTAAACATTTCGGTTCACCGAACCTAGTTTTACNAAAAAAAAA
page-top