Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig1963
Contig Information
Length 831 bp
Tissue Dormant seed with water absorption after breaking
Clones 7 Clones [Download: CSV  ,  FASTA ]
whei2b03    rwhei1b01    rwhei4b18    rwhei7c13    rwhei9i12    rwhei13g24    rwhei16m06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Glyceraldehyde-3-phosphate dehydrogenase, cytosolic >gi|18978|emb|CAA42901.1| glyceraldehyde 3-phosphate dehydrogenase [Hordeum vulgare]
Score 1056
Evalue 3.7573e-113
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1963
ATATTCTTCACAAACCACAACCAAAAAAGAGTACTTGATTAGCAACTCCATTACAGATACTAGAGGTTGATGCGGAAAACAGAAGGTAACTCATGTCCAA
CTAACATGAACCAGGCGTCGTCTGGCGACACCATCCACATTTATTCTTCGCATAGACAAAGCAGGGACACCTCTGACCAGGCGCCACAAACGAAAGCAGA
ACGCTCTACTGAGTCTTGGCCATGTGGCGGATCAGGTCGACAACGCGGTTGCTGTAACCCCACTCGTTGTCATACCACGAGACAAGCTTGACGAAGTGGT
CGTTCAGAGCAATTCCAGCCTTGGCATCAAAGATGCTCGACCTGCTGTCACCGACAAAATCAGTGGAGACCAAATCCTCCTCGACGTAACCCATGATCCC
CTTGAGTTTTCCCTCGGATGCAGCCTTGATAGCCTTCTTGATGTCATCATATGATGCAGCCTTCTCGGTTCTAACAGTGAGATCAACAACTGACACATCC
ACAGTGGGAACCCGGAAAGACATACCCGTAAGCTTGCCATTCAGCTCAGGAAGAACCTTACCAACAGCCTTGGCAGCACCAGTGCTGCTGGGAATGATGT
TAAAGCTTGCGGCCCTGCCACCTCTCCAGTCCTTGCTCGAGGGACCATCAACGGTCTTCTGTGTGGCAGTGATGGCATGAACAGTGGTCATCAAACCCTC
AATAATACCGAAGTTGTCATTAATGATCTTAGCTAGGGGAGCAAGGCAGTTAGTGGTGCAGCTAGCATTTGAGACAATGTTAACGTCTGAGGTGTACTTG
TCCTCATTGACACCAACCACAAACATAGGGG
page-top