Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1476
Contig Information
Length 523 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 9 Clones [Download: CSV  ,  FASTA ]
whfl10e12    whfl26i16    whfl26h05    whfl13k14    whfl50n06    whfl8i17    whfl13l01    whfl53a13    whfl17l02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Hypothetical protein CBG10720 [Caenorhabditis briggsae AF16] >gi|187030840|emb|CAP30041.1| C. briggsae CBR-COL-103 protein [Caenorhabditis briggsae]
Score 90
Evalue 0.135215
Total Hit Count 91
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1476
ggtCTCCCTCTTTCCTCTCCATCGTCTTCTTCCCAGCCTCACCTACTGCTACTCTTTCTCTCTCCACCCAAAACTGAATCCCCAAAGCGCCAGCGACAGA
ATCACGCGACGGCGCGAATCTTCGTCCCGTAAACCCTAGCGCGGTCTACCCTCCTCAGCCCGGAGCCGTCTCCGTCGCCTCGTCCACCGGATTCCCCGAC
GAGGGTTTTGGGGAGGGTGGTGCGCCGCCCCTGCCGTCCGGGGATAGCCTGCGCGTCTCGATCTCGGGGGAGCTAGGGTTTTGTGATCTGAGGCCTCGAG
GTCAGCGGCGTCGCCCTGGTTCTGATGAGAATTGGCAGTCTAATGCTCAGATTGGCCGCCGGCGACGACGAGAGGAGCAGCTTCGTTGGCAGCGGCGGCG
GAGGCCTCAGGTTCACCGCTCCCAAGGTCCGTACACGGGACAAGGGCGCCCCTATATCCCTCTAATTCCAGAGGGTTGCTGGTGTTgagacgtggagcct
tcgctgaagaaactggggaatga
page-top