Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig1876
Contig Information
Length 757 bp
Tissue Dormant seed with water absorption after breaking
Clones 6 Clones [Download: CSV  ,  FASTA ]
whei7d01    whei11c12    whei11k10    whei14a10    rwhei1a12    rwhei11c12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L13a [Triticum aestivum]
Score 989
Evalue 1.846e-105
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1876
ACCCTAGTAGCGCCGCCGCCGCCAGGTAAGAAGGCGAGATGGTGTCCGGCTCCGGCGTGTGCGCCAAGCGCGTGGTGGTGGACGCCCGCCACCACATGCT
CGGCCGCCTGGCCTCGATCGTCGCCAAGGAGCTGCTCAACGGGCAGCGCGTGGTGGTGGTCCGCTGCGAGGAGATCTGCATGTCCGGCGGCCTCGTCCGC
CAGAAGATGAAGTACCTCCGCTTCCTCCGCAAGCGGATGAACACCAAGCCCTCCCACGGCCCCATCCACTTCCGCGCCCCGGCCAAGATCCTCTGGCGCA
CCATCCGCGGTATGATTCCGCACAAGACCGCGAGGGGCGAGGCCGCGCTCGCCAGGCTCAAGGCGTACGAGGGCGTCCCGCCGCCGTACGACAGGACCAA
GCGCATGGTCATCCCCGACGCGCTCAAGGTTCTGAGGCTGCAGCCTGGGCACAGGTACTGCCTCCTCGGCCAGCTCTCCAAGGAGGTCGGATGGAACTAC
GCCGACACCATCAGGGAGCTGGAGGAAAAGAGAAAGGAGAAGGCCAAGGTCTCCTACGACAGGAGAAAGCAACTGGCGAAGCTCCGCGTCAAGGCCGAGA
AGGCGGCCGAGGAGAAGTTGGGAACTCAGCTGGAGATCCTAGCCCCGATCAAATACTAAGAGAGATTAGAGCTTCCGTGCGCCATCAGTTTTGGGAAACC
TCTGTCCTCTTGTCTTTGAGTAGTTTGGTAACTCTGTGATAGTACAACCCTGGTTGG
page-top