Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig1873
Contig Information
Length 768 bp
Tissue Dormant seed with water absorption after breaking
Clones 6 Clones [Download: CSV  ,  FASTA ]
whei14a15    rwhei1a03    rwhei1a04    rwhei7d20    rwhei8d07    rwhei14a15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein S7 [Triticum aestivum]
Score 980
Evalue 2.1096e-104
Total Hit Count 307
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1873
CTTTACATTGTTCACGTTCATTGCCAATCTCCATCAAACTTCCTAACCCCAGATCGTTAACAAAACTATGTTTCTGGAATACATTGATAGCACAACTAAC
TGAGACCTCGACCAAAACATTCGGATCAGAAAGATATGAAAATGGAGACATAAGGCATGGATCTTCAGGCGGTTTCAGTCACAGGGTACTCAAAGACAAC
GTCTTTCCCACAAAGCCTGCGGTAGACTGCAGAGAAGGTCTCCAGCTTGTATTCAGTGTTGTTGCGCTCCTTTGGGTCCAAGTAGATCTTGATGACCTTG
GCACCATCCAAACGGTATCTGACACGCTTCCCCACAATCTCAGCTGGGTACACGACATCCTCCAAGATACCATCATGAACAGCTGTCAGGGTCCTGGTGC
GAGGGCGCTGAACAGCAGAACCCTTCTTGGGTGGCCTCACAATCCTTCTTGTTGCAACAAAGACAACATCCTTGCCGCTAAACTTCTTCTCCAGCTCCCT
GACGAGCCTGACATGGATCTTCCTGAAGGGCTTGCGCAGACGGTACGGCACATGGATCACCACGGCCTTCCTGTTGCCAACAACATCCATCTGGATTGCA
GTGTTGATGTACAGGTCCTTGAGGTCGCTCTTGAGCTCCTGGTTGCCATTCTCCAGGTCAAAGAAAGCCTGCGCAACGGTGTCCTCGAACTCGGAGGGCT
CGACGCCCTTGTCCTTCTGGATCTTCTTCCTGGCGGTGTACATCTTGCTTCCCTTTCGCCGGGCCCTG
page-top