Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig1539
Contig Information
Length 804 bp
Tissue Dormant seed with water absorption after breaking
Clones 4 Clones [Download: CSV  ,  FASTA ]
rwhei3a17    rwhei6h16    rwhei7g03    rwhei12g21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine synthetase 2 [Triticum monococcum]
Score 708
Evalue 7.99429e-73
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1539
ACATTTGGGGAGACAGAGCAATAGAATTACACATCGCTCTTTATTATCTTTCCAAGACTCAGGAAGAAAGAGCATTATGAGGGAACTACACAACAAAGAA
TATGATAAGTGAAAGTGACAGAGCGACTAACAGAGCAAACTGCACATAGCTCAGCAGTTTCAGCGACTCAAAATGGAAAGGATAAATATATGAAATGACA
ATAAGAAACTTAGCACTGACTACCATACAACAAGACCAGTGTAGAGCGTCGCTTCAATATCTAATGCTTCTTCTCACTTCCCAGGAGCAACATGATCCCG
TCTTGACGAACTTGAGAGGCGGCAGACCAAGAGAACGCCATGCTCTTAGGCAGATGCCTTGTCGAACTTGAGGGGCTTCACCACCTCCCAGGTGAAGTCG
GCATCATCGCGGCCAAAGTGACCGTAAGCAGCGGTCTTGATGAACCTGTTTCCACCTTTCTTCAAGTCCAGGTTGATGCTGATCATCCCGGGCCTGAAGT
CAAAGTTCTCCTTCACGAGCTTGAGGATCTCCCTGTCGGGGATCTTGCCGGTGCCGTAGGAGTCGACGAACACAGACAAAGGCTCAGGCACACCGATGGC
GTATGAGATCTGCACAATGCAGCGGCGTGCGAGGCCGCTGGCGATGATGCTCTTGGCGGCCTGCCTGGCAATGTAGGCGCCACTGCGGTCGACCTTGGTT
GGGTCCTTGCCAGAGAAGGCACCGCCGCCGTGGGCTCCCCAGCCACCATAGGTGTCGATGATGATCTTGCGGCCGGTGAGACCGGCGTCACCATGGGGGC
CGCC
page-top