Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig1424
Contig Information
Length 716 bp
Tissue Dormant seed with water absorption after breaking
Clones 3 Clones [Download: CSV  ,  FASTA ]
whei9d21    rwhei3h15    rwhei9d21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit vacuolar proton-inorganic pyrophosphatase [Hordeum vulgare]
Score 694
Evalue 2.68729e-71
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1424
TTATCGTCGTCATCATGGGACGAGGAAAATTTGCCAGACACATACCAATAATGACCGAGGACATCCGGTCTCTCTCTTCTACTACATAGAGCTACAAGCC
GGTAATGGTGAGACTAACGTAACACACCCAAGAGGCCAAAGGGAAAGTGGGGGTAAACTGCGGCAATCCTGGAATAATGACACAAGAACCAAAAATAACA
GCAGCGCACAACATACGAACGGCGGGCGGGCGGGGCAGAGTTATTCGTGATGGTGATGGTGTCCGTAGATTCTAAGTCCGCTCGACGAGTCTTCTAGATG
TACTTGAACAGCACACCTCCGTACGTGGCGAAGAAGGGCGCGAACACGAGGGACTCGACGGCCATCAGCTTGATGAGGATGTTGAGCGACGGGCCTGAGG
TGTCCTTGAGGGGGTCTCCGATGGTGTCGCCGATCACGGCCGCCTTGTGGCAGTCTGAACCCTTGGGGCCAAGGGACCTCGCGTGCTCGCTGTTGCCGGC
CTCAATGTACTTCTTTGCGTTGTCCCATGCACCGCCGGTGTTGGAAGCAGAGATGGCGATCTGTACTCCAGAAACAAGGGCACCAGCCAGAACACCAGAC
AGGGTTTCCACGCCGAAGAGGGTTCCGACAATGAGGGGGGTGAGCATGACCAAAGCACCCGGAGGGATCATCTCCTTGATGGAAGCATCANTGGANATCT
TGACACAGGTGGCATA
page-top