Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig1414
Contig Information
Length 839 bp
Tissue Dormant seed with water absorption after breaking
Clones 3 Clones [Download: CSV  ,  FASTA ]
whei18l11    rwhei1c09    rwhei18l11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09713 [Oryza sativa Indica Group]
Score 812
Evalue 7.53893e-85
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1414
AGCGAGACACGCTAGTTCACCAAGTCATACAATAAGGCAGTACCGTGCGCGCTAAGAGCATTTAGCATGTTTCACATGCCTCAGTGGAGCAAAATTTTAT
TACAGCCAACAAGATCCCTAGTGTTCCTCAAGACTAGCTAATAACTGGGTTGGGCTGCTGGGGCAGCTTCACTTCTTCACCTCCTCGTACTCGGCCTCTG
GGGCCTGGTCGCCTCCGCCCTGCGAGCCTCCTTCCTGGGAACCACCGCCAGCCGCGCCGCCTCCAGCCGCACCACCACCAGACATGTGCTCCCCGATCTT
TGAGACCGCCTTGTTGGCCACTTCCATCTTGCTCTTTATCTTCTCGATGTCGTCAGAGGCCATCTCCGCGCGGAGATCAGCAACCGCCGTCTCGATCTCG
GTGGCGACCTCCGCGGGGATCTTGTCCCTGTACTCTCCCAGGCTCTTCTCGATGCTGTAGATGGTGGTGTCTGCGGTGTTTCTGATGTCAATGAGGGCCT
TGCGCTCCTGGTCCTTCTGTGAGTGCAACTCAGCCTCCCGCACCATCTTCTCGATCTCGGACTCAGAAAGCCCACCGGACGATCGGATGGTGATCTGCTG
CTCCTTTGCGGTGGCCTTGTCCTTTGCAGAGACCGTCACAATTCCATTGGCGTCAATATCAAACGTGACCTCAATCTGTGGCAGTCCTCTTGGGGCTGGT
GGGATGCCCACAAGATCAAACTCGCCAAGAAGTTTGTTGTCTGTTGCCATCTCACGTTCACCTTGCAGGACACGGATACCCACTTGCGTCTGGTTGTCAG
CAGCAGTTGAGAACACCTGGCTTTTCTTTGTGGGGATTG
page-top