Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig1410
Contig Information
Length 889 bp
Tissue Dormant seed with water absorption after breaking
Clones 3 Clones [Download: CSV  ,  FASTA ]
whei8f15    rwhei1d14    rwhei8f15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0115500 [Oryza sativa (japonica cultivar-group)] >gi|7248415|dbj|BAA92738.1| putative 60S ribosomal protein L13E [Oryza sativa Japonica Group] >gi|24413953|dbj|BAC22205.1| putative 60S ribosomal protein L13E [Oryza sativa Japonica Group] >gi|113594653|dbj|BAF18527.1| Os06g0115500 [Oryza sativa (japonica cultivar-group)] >gi|125553806|gb|EAY99411.1| hypothetical protein OsI_21382 [Oryza sativa Indica Group] >gi|125595832|gb|EAZ35612.1| hypothetical protein OsJ_019095 [Oryza sativa (japonica cultivar-group)] >gi|149391053|gb|ABR25544.1| 60S ribosomal protein l13-2 [Oryza sativa (indica cultivar-group)] >gi|215678596|dbj|BAG92251.1| unnamed protein product [Oryza sativa Japonica Group]
Score 656
Evalue 1.75506e-70
Total Hit Count 313
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1410
GATAAAATCCAAGGACACTCATAGGATAAGATTTGATAGCAGATCATGCAAATAAGTATATCAGGTATCAAACAAGATGTCCGAGAAGGCCAAAACAGAA
ATTCAGAAACTAGCACTTGATAACAACAGAACCCACTAGCTGCCTTAAGCATCTCATCACTTCTTCTCCTCCTTCTCCGCCTCGGCAGCCTTCTTCTGCC
TGGCTCCCAACTGGCGCTGGTTCATCCTCTCGACACGGAGCTTGCCATAGGGCCTTGAACTCCTTCATCTCCTCTGTGACCTTCACGACCTCAACTGAGC
GCTTCTCACCGCGGGCAATGGGCATGTAGTCGCCCTGGACCTGTGTGGCGTTGGCAAGCTCCTCCGGAGTAGAGTCACCAGCCTTGACCTTGCGAGCACG
CCTTGGGAAGATAACAAGCTTGGCCTTGTAGGTCTTAAGCCTCTGGATATTGGACTGCATACCCTCAAGCGACCTGTTCTTGCGGCGATGGTCCACAGAA
ATGCCAATGGTAGGAGCGAGCTTCTTTGGGATGCCAGCGGACTTAAGCTCCTCAAGGGTAAAGCCTCTGCCAGCCCTGGCCTTCATGTTGTACTTGCGGG
TCTGGCATTGCACAATGGGGCGAAGAGGTCCAGAGGTGGGGCGAGGGAAGATCTTCACAGCCTTCTTCTGGCGAGCGATGCGGCGCCTCTGCTTGCGGGC
GGGCTGGTTGAACCACGTCTTGACATAGTTCTGCCAGTGCTTCTTGAAAGTGGCCGTTGGGGATGACGTTGTTGTGCTTCACCATCTCGCCCTCCTTACC
TGGAGACGACGGTGCGGCGGCGGCGGCGGGGGAGGGCTAGGGTTTTGCGGGGGAGTGGAGCGGCGGGGGAGGGCTAGGGTTTGCGGGGA
page-top