Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig1297
Contig Information
Length 675 bp
Tissue Dormant seed with water absorption after breaking
Clones 3 Clones [Download: CSV  ,  FASTA ]
rwhei1e19    rwhei3k03    rwhei9f08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_10580 [Oryza sativa Indica Group]
Score 628
Evalue 1.07851e-63
Total Hit Count 308
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig1297
TTCAACGGAGCTCACGACACTCTAAAGCAAGTCTCATACTACTAATAGCAAACCACCGGCAGTGCAGCAAATACCATGAAAAGCATAGCTCATGTACACC
TAAACTACGCTGCAGAAGCCTCTCAGACTGTTGCCAACACGACAATGCCTTTCCTCCTGTGCTGTGCTGCCCCTGCGCTTCATTCCAGCTCCCTACTACT
GCAGCTCGCCGACGCACCACAGGTCCTCGGGGTCCTCCTCTCCCAGCGCGGGGTTCTGCAGCGCGAGCTCCTCGGAGACGTACGCCAGCCCCTGCATCAG
CCTCACCACCTCCGCCGTGTCGTCCAGGTAGTACTTGGCCTTGCTCGGCTTGCGGCCGACGGTGCAGGCGAACACCTCCGCCGTGGACGCGAACGAGTCG
GCGCAGGAGGAGCTGGTGATGAACTGGAACATGTCCTCGTCGGAGCGGTCGTCCCCGATGCAGAGCACGAAGTCCGGGCACATGCCCCTCTCCTGGAGCG
CCGCCAGCATGCGCCGCGCCACCAGGCCCTTGCTCACGCCCTGCGGCTTAGCTTCGACGGAGTGCACGGTGCTCTTCACGGACACCGGCTCGTTGGTGAG
CACGCTCTCGAGGTGGTCGACGAGCTCCTTGGCCTGGCATGACCCGAAGTCGGGGTCCGCGTCCTCNTAGTTCCA
page-top