Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig950
Contig Information
Length 813 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhei1f03    rwhei1g05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit succinyl-CoA ligase beta-chain [Zea mays]
Score 915
Evalue 8.11528e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig950
CTCATTTTGTGCCCATATAGGTTTATTAACACAAAGATCACAAGTTTGAAGGAAAACTCAAAGTGGAATCACTCCACTTCAAAAAAAATATACTTCAAGA
TTTCGGCCCCCAAAATCACCAAGAGAGCACCACTCCTCTTGTACCAGTGAAAACAGAACTTTAGACTGATATGGTACAATCATTAATCATTTGACTGATG
CTTTTACAGCCTTCTCTGCAGCATCATCAAGATCCTCTGCAGTGATCAATGTCATTCCACTTTCCTTAAGAATCCTTTTCCCTTGGTCTACATTGGTGCC
TTCTAGCCGAACAACAACAGGGACCTTAAGATCAACCTGTTTAGCTGCATTCACTATTCCACTTGCTATCACGTCACATTTCATGATACCTCCAAAAATG
TTCACTAGAATTGCCTTCACTCTATCGTCTGAAGTCAATATCTTAAATGCTTCCACAACCTGTCCCTCGGATGCACTCCCACCAACATCAAGAAAATTGG
CAGGTGTACCACCATGCAGCTTAATGATGTCCATCGTAGCCATTGCCAATCCTGCACCATTCACCATGCAACCAATCTCTCCATCAAGCCCGATGTAGTT
CAAATCTGCTTTAGCAGCAGCCACCTCTCTGGGGTCCTCCTGTGTTGTATCACGCAGTGCAAATATTTCTTTCTGCCTAAACGCAGCATTATCATCGAAG
TTCAACTTTGCATCAGCAGCAACTAGCTTTTTATCAGCTGTCTCAGCAAGAGGATTTATCTCCAGCATTGTGCAGTCGGTCTTGCAGAAAAGTTCATATA
GCTTCTTAATCTG
page-top