Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig943
Contig Information
Length 739 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhei1d22    rwhei15e01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0281900 [Oryza sativa (japonica cultivar-group)] >gi|113563937|dbj|BAF14280.1| Os04g0281900 [Oryza sativa (japonica cultivar-group)] >gi|215686499|dbj|BAG87760.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218194508|gb|EEC76935.1| hypothetical protein OsI_15195 [Oryza sativa Indica Group]
Score 540
Evalue 1.32882e-54
Total Hit Count 122
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig943
AGCACCTTACAAGCAACTGAACTCCTTAAATTAGGAAGCTCATCGTAGTTACATAGATCACTTGGGTGCCTGCAACGGAACTAGGTTCGCATTTTTGGAA
CGCATCAATGAATCCACCACAGCCTCACAGCAGAAGATTCAAAGCTAGTACGGTATATATAGAATAAAGTAAAAAGAGAGGCAGATGCACTATATGTAGC
TTGAAATTAACTATGAGCCCTTACAGATTATTTCGTTCGCCTACACACACAGCGATACTACTACGTACGTACGTGTTTTGAGTTTTGACCCGTCATCGAG
TAGCCAAGGCACAGCAGCTAGGGATCCTCTCGGCTCAGCGCGGGAAGGCAGCGATCTCGACGCCCTTGTTGCCGAGCGAGGGCATGGGTGCGTCGTAGGC
GCTGAAGAGGCGGTAGGACGAGATGAGGGAGAGGAGGATGTAGCAGACGACGGAGCCGAAGGTGATGGCCACCGACGTCCGGGCCTGCCTGCAGAAGCCG
CCGAACACGCCGCACGCCTCGCTCCACGTCACCTCCTTGTCGCCGTTGTACGCCAGGTAGAGTAGCTCTGCCGACGCCGCGCCGGCCGCCAGGATCAGGT
ACGTGAACACCTGATCTAGGAGGAAGACGATCCAGGAGCGGGACAGGGTCGCCGGCCGCGGCACGGCAGTGTANAACGCGGAGACCAGGGAGTAGGCCGC
GCACAGCCCCGTTGGCATAAACCAGGTACTTGAATCCGC
page-top