Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig937
Contig Information
Length 685 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhei1c14    rwhei17n24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative fructose 1-,6-biphosphate aldolase [Triticum aestivum]
Score 780
Evalue 2.63584e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig937
CATTCTGCTCAGCAAATGTATTACAGGGGATTCAACGTCAAAAATTAACTATAAGTAGAAGCTTATATTATTAAAAACAAGGATTGATATTTAAAAATAT
CAAGACTATGAAACCAAACAGATACTACTCCGTCCAAAAATAAGTGTCAGACACTTATTTTCAGACGGAGGTAGTAAGCAGGAATGCCCAAACCATCCAG
CGGGGGGCAGATCAGTACTTGTAGTCCTTGACATGGAGGCTCTCCGAGGCGCCCTCGGCAAGGGTGGCGTCGCCCTTGTAGGTCCCGAGGGTGGCCTCAG
AGTTGGCCTTGCACCTCACCAGGAACGCCGCCCTGGCCTTCTCCTCATTCTCCGTCTTGCCGGACCAGGCCTTGAGGGTGCTCTGCTGGAGGGCACGCCC
GAAGGAGAAGGACAGGTTCCATGGCTTCTTGGTCTGGAGCTTGTTCATGGCGTTCAGGTTCAGGGTCGCCTCCTCCTCGCTCTGTCCACCAGAGAGGAAG
ACAATGGCGGGGACGGCAGCAGGGACGGTCCTCTGGAGGGTGCGGGCGGTGTACTCAGCAATCACCTCAGGGGCCACCTTCTTGGAGTCGGAACCAGGGG
TGACCATGTTGGGCTTCAGGAGGGTGCCCTCGAGGAGGACATGCTGGTCGTTGAGGGCCTTGTANCANGCANCAAGGACGATCTC
page-top