Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1377
Contig Information
Length 706 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 8 Clones [Download: CSV  ,  FASTA ]
rwhfl14f20    rwhfl27d11    rwhfl10c13    rwhfl27c12    whfl27d11    whfl27c12    whfl10c13    whfl14f20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal Pr 117 [Triticum aestivum]
Score 723
Evalue 1.12209e-74
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1377
acGCCCTAAACTTGTTATGTGATGCT*GCA*TGAATACTCTCAGCATGCCAAACCAAAACAGAGATACGCAAAGTTCACCATTTTATCTGGCAACAAAGC
TACAGCTGTTAAACTAAGTAGACAGGCAGGCTTCTGTTCACCAACTAACTGAGATGCCAAACAACAGAGCAACGCGAAGTTCCACTCCTATTTTCCAGGG
CAAAACAGTTGCAACCCACACTGACATTATATAAGCAGTACCACAACTTGAAACAAGCTCTCAAACGATGGCATTGGCGTTGCTGGCGATCCTGGGCCAA
AGGTCAGCACACTCCTTTCCCACAGGTCCAGTGATAGCAGATCCTTTCATCTCACCCTTGGGATTTACGATCACTCCAGCATTGTCTTCGAAGTACATGA
AGACGCCGTCCTTGCGGCGCCACGGCTTGCGCTGGCGGATGATGACGGCGGGCATGACCTTCTTGCGGAGGTCGGGCTTGCCCTTCTTGACGGTGGCCAT
GACCATGTCGCCGACGCAGGCGGACGG*GAGGCGATTGAGGCGGCCCTTGATGCCCTTCACGGAGATGATGTAGAGGTTCTTGGCGCCCGTGCTG*TCGG
CGCAGTTCACCGTCGCCGCCACAGGCAGCCCCAGCGACATCCGGAACTTGTTCCCCGCGGAGCCTCCCCTCCCTCGCTTCGACATGGCGGCGGCTGCGGT
TGGacc
page-top