Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1370
Contig Information
Length 1055 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 8 Clones [Download: CSV  ,  FASTA ]
whfl9m23    whfl9p08    whfl9o23    whfl10h06    rwhfl9m23    rwhfl9p08    rwhfl10h06    rwhfl9o23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit small GTP-binding protein [Triticum aestivum]
Score 736
Evalue 7.07722e-76
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1370
acGGAGTCGCCAAGAAGAAAGTCCCAAACTTTTTCCTCTCGATCGATCCGTCCTCCTCCTCGTCGCCACAGGAGTTTCTCCCCGGATTCGCCGCCCTCTC
CTTCTCTCCAGCGAGCGAGCGATCGGATCCCGCCGGCCGGAGGCCCAAGCCCCGCCCGATCTACCCGATGGCAGCCAACGCCGGCGCCGGCGCCGGCGGG
AGCAAGATCCGCAACGCCAAGCTGGTTCTTCTAGGCGACGTCGGCACCGGCAAGTCCAGCCTGGTGCTCCGCTTCGTCAAGGGCCAATTCGTCGAGTTCC
AGGAATCGACCATCGGTGCGGCTTTCTTCTCGCAGAACCCTGGCGGTCAACGATGAGACGGTCAAGTTCGAAATCTGGGACACGGCCGGCCAGGAAAGGT
ACCACAGCTTGGCGCCCATGTAACTATCGCGGGTGCCGCGGCCGCCATCGTCGTCT*ATGACATCACCAAC*GCGGCCTCTTTTACACGTGCAAAGAAAT
GGGTTCAAGAACTTCAAGCAC*AAGGGAATCCAAACACAGTAATGGCTCTTGCTGGGAACAAGGCTGATATGTTGGAGGCAAGGCAGGTGCCAGTGGAAG
AAGCGACGACTTATGCACAAGAGAATGGGCTCTTCTTCATTGAAACGTCTGCCAAAACAGCCATCAATGTGAACGACGTATTCTATGAGCTCGCAAAGAG
ACTGCTCGCAGGGCAGCAGGCGCAGAACCCGCAGGCGGGGATGGTGCTCTCACAGAGACCGGCCGAGAGGATGGTGAGCAGCACGTCGTGCTGCTCATCA
TAGGACGCTTTGCCGTGGAGAGACGGCCGCCATGGATGGCCTCAGAAGCCACAGAAGGAAAAAAAAATGTATGCGCTGTGGACGATTGCTGCCATCCCAG
CTTGCTACACTACAGTCTAGCCCTTGTTTCTTGTCATATGTTGGTTCTGTAAATGTGAATAGTAGTGGGGTGTTGCTGCTGCATGTTCAGATATGTTGTT
GCAGTGCATTCTGGTGCTTAAATATATTTCTGGATGACCTTTGTGCTTCAATTat
page-top