Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1366
Contig Information
Length 553 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 7 Clones [Download: CSV  ,  FASTA ]
whfl25f18    whfl51j12    whfl15m06    whfl18a08    whfl52c24    whfl46f05    whfl10f07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_008270 [Oryza sativa (japonica cultivar-group)]
Score 648
Evalue 3.09169e-66
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1366
gcACGCGGCCGCTTCCCATCCCCAACCCTAGCCGCCAGCAGCTGAGGAACAAGGAGGCAGTCCGGGATGCGGCGATCAGCTATGGCGCTCCGCTCCACGG
CGGACCGGTGCTTCGGCACCACTCACCGTTGACGAACGTTATTCAATCAACATACAGTGCAAACATTGGTTCAAGATTGGGAAGTCTTGCAAGAGCTTTC
AGTGCAAAACCACTTGGAAATGAGGTTATTGGGATTGATTTGGGAACAACAAATTCATGTGTTTCTGTTATGGAGGGAAAGAATGCAAAAGTGATAGAGA
ATTCAGAAGGCACTAGGACGACACCATCAGTTGTTGCCTTTAGTCAGAAGGGCGAGCGGCTTGTTGGAACTCCAGCCAAACGTCAAGCAATTACCAATCC
ACAGAACACCTTCTTTGGTACAAAGCGTAT*GATAGGGCGTCGCTTTGATGACCCACAGACGCAGAAAGAGATGAAAATGGTTCCATACAAAATTGTGAA
GGCTCCAAATGGTGACGCTTGGGTTGAAACAACAGACGGCAAGCAGTACTCac
page-top