Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig655
Contig Information
Length 1051 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei8b22    rwhei8b22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit casein kinase II beta [Hordeum vulgare]
Score 1279
Evalue 7.68094e-139
Total Hit Count 411
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig655
TCAACCCTAGTCCAGCCTGCGAGCGCCGACACGCCGCGCCGTGCGGCTTCCCGCAAGCAGGTGCTCCGGCGGACCGCGGGGGATGAGCGGAGCGGCCTAC
AGGGACCGGGGATTCGGCGGCGCCGCGGAGATGGACCGGAAGCGCATCAAGGAGGCGCTCGAGAAGCACACGGAGAGGCCGTCCCCGTCCACCTCCAGGG
GGGCGTCCAGGGAGAAGGAGCTGCTCGCCGCCGGCAAGATAACCACTCAGATCGGCAAGGTCCCCAAGGTCTCCGACGTCGAGGAATTCGAAACTGACAG
TGAAGATTCTGATGTTAGTGGTTCTGAAGGAGAGGATACATCTTGGATTTCATGGTTCTGTAGCTTGCGAGGCAATGAATTCTTCTGTGAGATTGATGAT
GATTATATACAGGATGATTTCAATCTCTGTGGCCTAAGCAGTCAGGTGCCATATTATGATTATGCACTTGATCTCATCCTAGACATTGAGTCTTCTAATG
GTGATGTATTCACTGAGGAGCAAAATGAATTAATTGAGTCATCTGCAGAGATGCTGTATGGTTTAATTCATGCACGGTACATCTTAACCAGCAAGGGTCT
AGCTGCAATGTTAGAAAAGTTCAAGAACTATGATTTTGGCAGATGCCCTCGAGTATACTGCTGTGGTCAACCCTGTCTTCCAGCAGGGCAATCAGACATT
CCTAGGTCAAGCACAGTGAAGGTGTTTTGTCCAAAATGTGAAGATTTACACTATCCAAGGTCCAAGTACCAAGGCAACATTGATGGAGCATACTTTGGTA
CGACATTTCCTCATCTCTTCTTGATGACATACCCACACCTGAAGCCACAGAAGCCATCACAGCAATACGTCCCAAGGGTTTTTGGCTTCAAACTTCACAA
GCAGTCATGACGAACTTTTACCAGTGGGCGCTATTTGTTTTTACCTAGTGTTAGAGATGGAACACCTTGGCCTGAAAATGTTGTGGCCTCTTGATTCGAG
TACTCGCGAGCTCGAATCTTGCTGTAAACTGCTGAGCAACTGTATCTGTTT
page-top