Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1323
Contig Information
Length 578 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 7 Clones [Download: CSV  ,  FASTA ]
whfl10g17    whfl41a02    whfl49m03    whfl49d07    whfl9j02    whfl14i01    whfl38m03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_34040 [Oryza sativa Indica Group]
Score 372
Evalue 3.62201e-34
Total Hit Count 71
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1323
acTTCCATTAAAACCCCACTCCCCTGCTTCGCACCTCCGGCTCCGGTACCCCGACGAGCGCCGAGGAAGCCATTGTGAGAGGAGGAGAGAAGAGGAAGGG
GCAGATCTATGGGCAACTGCAAGAGTTCATCTCGTGCACGCCTAGGAAAGGCCCATGTCGTTCCGGATTCAGAATGGAGGATGCAGGACTTTGGAAAGAC
CCATGTTCCTGATTTAGAATGGAGGATTAATGACTTCTCATCGCTGCTTGAGACAGGAGCTAAGTCAGCAAAATCTGACGCTTTTCACTGCTCTGGGTAT
AACTGGTACCTGCAAGTGAGTCCAATGCATAAGGAAACTGGTTCTGAAACGCCATATGTTGCTCTTTGTCTTAAGACATCCCAACCAAGCATGGTGCCAG
GTCACACGGTGCATGTGGTTTTTGAGTTGTCAATATACAACCATACAAAAGGAATGTACTGTGGTTGCAAAGATACCTACAACTTTCATTTCAAGAATAC
CTACTCGAAGGAGCAATGCTTGATTCCTCTTCAGGAGCTACTGAAATCATCTGCTTTTCTAGTTGATGATAgctgtgt
page-top