Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig272
Contig Information
Length 695 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei1h13    rwhei1h13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit immediate-early protein RSP40 [Zea mays]
Score 138
Evalue 7.44416e-07
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig272
GTGGAGGGTGAGGAGAAGGGGTCGGCGCCGCAGCAGGTGGTCGACATCTCCGACGAGGACGACGGCGGCGGCGACGAAGAGGAGGGTGGTGACGATGACG
ACGACGACGACGACGACGATGATGACGAGGAGGACGACGACGAAGTCGACGAGGAGGAGGAGCCTGAGGAGGAGCTAGGAACTGAATATCTGGTGCAGCC
GCTTGGCCGTGCTGAAGACGAAGAGCATTCCAGTGACTTTGAGCCAGAAGAAAATGGTGATGGTGCTGAGGACGAGGAGATTGAGGATGATGATGCTGAG
GATGGTGAGGATTCTGTCAAGGCGCAATCCTCTTCGAAGAGGAAGAGGTCTGGCGCGGAGGATGAAGATGATGATGACGGTGATGATGATGGTGATGATG
ATGAGAAGCCTCCATCAAAGCGATAGTCAATTTGTTCTTGCTGATCTGGTATCTTTTCTGCTTGGGCCAAGAAGGAAAATAATCCTCACGGAGAGGGTTG
TTGGTAAATGCTGTAGCTTTAGGACATCTGTGGTAGGTGTAGCAGCTCGAACTTGAGTCTACCCATGTTAGTTGTTAGTGCATACTGCTGATGTTGATTA
ACAGCCTCGGGGAACTTCTGTATGAGCATTAGATATGGGGCTTGTTATATGCTTGTGTAGCTTCTGATTAAAACCCTGTGGAATGTGGATGCTCT
page-top