Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig13
Contig Information
Length 743 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhfl5j04    whfl5j04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 17.4 kDa heat-shock protein [Triticum turgidum subsp. durum]
Score 709
Evalue 5.30933e-73
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig13
aaccgacCAAAGCATTCCACAAAATTCAACAAGCAATCCAACGCAAGTCCAACCCGAGGAGATCGACCGAGCTCGAGATCAGCGAGCGAGAATGGCGGGC
ATGGTGTTCGGCTTGGAGAACCCGATGATGACGGCACTGCAGCACCTGCTGGATATCCCAGACGGCGAGGCCGGCGTCGCCGCCGGCGAGAAGCAGGGCC
CTACACGTGCCTACGTCCGGGACGCGCGCGCCATGGCAGCCACCCCGGCGGACGTGAAGGAGCTGCCGGGCGCGTACGCGTTCGTGGTGGACATGCCGGG
GCTGGGTTCCGGCGACATCCAGGTGCAGGTGGAGGACGAGCGGGTACTGGTCATCAGCGGCGAGCGGAGGAGGGAGGAGAAGGAGGACGCCAAGTACCTG
CCGATGGAGCGCCGCATGGGCAAGCTGATGCGCAAGTTCATGCTCCCCGGCAACGCCGACATGGAGAAGATCTCCGCCGCGTGCCGCGACGGCGTGCTGA
CCGTCACCGTCGAGAAGCTGCCGCCGCCCGAgcccaagaagcccaagaccatccaggtccaggttgcctgagctggtatgcattgtgtgcgcgtcgaatc
gaagcagagtttgagtggctgagtgggtactgagtttcctgtgatgatgagtgatggtttctctgtcttttgatctcgtctgctagagagagtgtgtgtc
gtatcgattcgtgcgcactggtgatggtttgattttcgttaat
page-top