Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig100
Contig Information
Length 967 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei12p02    rwhei12p02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0234900 [Oryza sativa (japonica cultivar-group)] >gi|56783949|dbj|BAD81386.1| putative ubiquitin ligase SINAT5 [Oryza sativa Japonica Group] >gi|113532049|dbj|BAF04432.1| Os01g0234900 [Oryza sativa (japonica cultivar-group)] >gi|215767958|dbj|BAH00187.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1403
Evalue 2.82034e-153
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig100
TGCCCCGTCTGCACCAACTCCATGTACCCGCCGATCCACCAGTGCCAAAATGGACATACTCTGTGTTCCACATGCAAAGCTAGGGTACACAATCGTTGCC
CTACTTGCCGACAAGAGCTCGGTGATATCAGGTGTTTGGCACTGGAGAAAGTAGCCGAATCGCTTGAGCTTCCCTGTAAGCACTATTCCTTGGGTTGCCC
AGAGATCTTCCCATACTACAGCAAGATAAAGCATGAAGCGATGTGCAGCTTTAGACCATACAGTTGCCCCTACGCTGGTTCTGAGTGTTCTGTGACTGGT
GATATTCCTTACCTTGTTAACCATTTGAGTGATGACCACAAAGTTGATATGCACAGCGGTTGCACATTCAACCATAGATACGTCAAATCCAACCCAAGAG
AAGTCGAAAATGCCACCTGGATGCTAACGGTGTTTCACTGTTTCGGGCAGTACTTCTGCCTGCACTTTGAGGCCTTCCAGCTTGGGATGGCACCAGTGTA
CATGGCCTTCCTGCGTTTCATGGGGGACGAGAATGAGGCGCGGAACTACAGTTACAGCCTTGAGGTCGGCGCCAATGGCAGGAAGATGGTATGGGAGGGC
ACCCCCAGGAGCGTCCGGGACAGCCACCGGAAGGTGCGTGACAGCCACGATGGTCTCCTAATCCAGAGGAACATGGCATTGTTCTTCTCGGGCGGCGACC
GGAAGGAGCTGAAGCTAAGGATCACCGGCCGGATCTGGAAGGAGACGCAGACCCCGGATGGTGCCTGCGTACCAGTTCTCTGTAGCTAAGCACAAGCAGC
GAACAATCTTCAAAAGAAAAAAAAAGGATTCGATATCATATGTGACATGATATCGCCTATCCCGTCGCCATGCCCTACTGTTATCGTATGGTCTGAGGCG
ACGTTTCATGGTTTTGTCTTTGTTGAGCAAAATTAGGAGGCTAGGATGACCCTTGTAAAGTAAACCC
page-top