Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig97
Contig Information
Length 994 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei12p22    rwhei12p22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0730400 [Oryza sativa (japonica cultivar-group)] >gi|46390465|dbj|BAD15926.1| putative NHL repeat-containing protein [Oryza sativa Japonica Group] >gi|46390861|dbj|BAD16365.1| putative NHL repeat-containing protein [Oryza sativa Japonica Group] >gi|113537544|dbj|BAF09927.1| Os02g0730400 [Oryza sativa (japonica cultivar-group)] >gi|125541002|gb|EAY87397.1| hypothetical protein OsI_08804 [Oryza sativa Indica Group] >gi|125583566|gb|EAZ24497.1| hypothetical protein OsJ_007980 [Oryza sativa (japonica cultivar-group)] >gi|215715228|dbj|BAG94979.1| unnamed protein product [Oryza sativa Japonica Group]
Score 257
Evalue 2.27515e-20
Total Hit Count 38
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig97
ATCCCCGAATTCCTCTCCCTCTCCCTTTTCCCTCGTCTGCCGCCGCCACTGGCGACCTCGCCGCAGCCGCCGTGACCATCCACGCCCTCCCCAACGGCCA
CCCCTTCTCTCCTCCCCTTACCTTCTCCTTACAATCGGCAACCTCCTCCCCTCTCCCTCGCACCAGATCGAGCAGCAGGCCGGGATCCGAAGCAGCCTCA
GATCCGGCACGCCGAAAGCGATGGTTTCCGTTGAGAACGCCATGGACAAGGTGCTCTGGCCCGGTTGCTGCAGCCCATGGACAAGATGTGTGCGGATCGG
ATGAAGAATAGAAGAGGAAGGATCTTGAGTTCCTGGAGTTGCTGAAGAATTTGATATAAGTCAAGGTTAAAATTTGAACAGGATAGGTGTCTACACCACG
AAAGAAAATGAAGATATATACTTGCATTAGATGAAAGTGGCACAACAACAACAATACATAACAGAAACATAGTGTATCAAGAAGCGTCGGCTGCCTGTAG
GAGATATTTTGCCCTGCAGTTTCAGTTTGAGATGAACTTTACAGAGACATCTAATCATTTCCCACCAGTGCATGTTTTGAAAAAAAAGCTGAGTGTTGCT
GATGCAAATAAGTCAACAGTCTAGATGCATTTATGGAATTACAACTATTGCTGGTGGGAAATCAAGCAGAGGAGGGCATGTTGGTGGACCAAGTGACGAT
GCAAAATTTGCTACTGATTTTGAAGTCCATTACATTGCCAGTCGTTGCTCCCTTTTGGTGATTGACAGAGGAAATCAAGCTATTAGGGAGATTCAGCTCA
ACTTAGATGACCGTGTGTACCAGTATGAAGCTGGTTTTCCTATAGGTATGTATTGTGCAATTATTATATGCCCTGAGGGTTCATTTCACTAGGTTGTTCC
CTCACTAGATCATCCTAATAATGTTGAAGCACTGACATTCTTATTTCTTGTTGTCTTGTACATATCACTAGAATTCAGTATTGTGCCAAGCCGG
page-top