Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig96
Contig Information
Length 623 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei12p23    rwhei12p23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 86
Evalue 0.627638
Total Hit Count 8
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig96
GACTTTTCCTTCTCCGCCTCGAGTTGCTTCTTCCTCTTCCTCGCATGGCCGCCTCTGCCGCGGCCATTGCCTCGCTGCCCCCGTAGCCACCGAGCTCACC
ACGCCCAGCCACCTCGTCTACGAGCTTCGCCGACGTCCACTCCTTCGACTATGTCCACCAGTTGGAGCCGGTAGCCCCTGGATCGCAGGGATCGATGTCG
TCTTCAACCTCCAGCCACCGCGACATCATCGACGAATTCATCGCCGTCGCTCCACAACCCGACCTTCCCGAGCTCGCCTACGACATCGCGACTACGAGAC
CGACGATGTTGCTGCCCAGTTCGACTACGGAGTTGATGACCCCTCCTCCTTGCCAGAGCAACCAGGATCCAGACGCTACCGTCGACGACGACTACTACAC
TAGAGGAGCCTACTACTACGTGCAGGCCGCTGACGACGACCAGGAGTAGTTAGGAGGATCCCAGGCAGGAGGCCTGCGCCTCTTTCAATCTGTATCCCAG
TTTGTGCTAGCCATCTTATGGCAACTTGTTTAACTTATGTCTGTACTCAGATATTGTTGCTTCCGCTGACTCGTTTATGTCGAGCACTTGTATTCGAGCC
CTCGAGGCCCCTGGCTTGTAAAA
page-top