Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig94
Contig Information
Length 865 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14d22    rwhei14d22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein PTRG_04084 [Pyrenophora tritici-repentis Pt-1C-BFP] >gi|187980296|gb|EDU46922.1| hypothetical protein PTRG_04084 [Pyrenophora tritici-repentis Pt-1C-BFP]
Score 482
Evalue 1.45916e-46
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig94
CATGGAGGAAGTTGTCAGTCCAGTTGCTCCTGGCAGTCCGAATCGCGCGAACTTCTCATATCCCGCGAGAGCACCGCCTCAAGGAGTTCCACGACAAGTG
CCTGTTGACAGTATGCCACCACAGCAACAGCAGGCAGGCGTACCGCCTGTACCTCCAGTACCAGGACAACAGCAACAACGGCGATCAAGTATCCCTCAGC
TACCTGCGCACCAGCAACAGCAATCTGGTATGCCGCCGCCCATGCCTAGCCAGCAGCCGTCGAGTATACCCCCTAGCCTACAATCTGGCATCAATTCCAA
CCCAAACAACGACCCAAACCGTCCGGTCCCATACCGAGCTGGTCATGATTTGAACAAGCAGAGCACAATGGCAAACCTCAAAGCGGCGGCAGCAGGTATC
CACGGCGCGGGAGAAACCCTCCGTGGAACATTCAACGACACATTCGACCGTCGCAACCCCGCCGCCCACGCAAAAAACCAAGCCGTAATCGACAAAGGCC
GATCGGAAATCGAAACCGCACGCGCCCGCCAATACGCGAACCAACAACAGCAGCCACATATGGCGGACCAAACACCAGTGCAGCACCACCAACAACAAGC
ACCTATAATCGGAGCTGCACCGCCACCTCCTTCTCAGCCAAGTATAGGACCATCTACGGTGCCAGGAAAGACGGCGTACCAGGGGCCACCAGTCTCTGGA
TCACAAATTGAAGGGGGAGGAAGAAGTGGTGGAGGCTCGAAATTGAGCAATATTATGAAGAAGATGAAGGAGGGTCCAACTCCGCGTCAAGATGGGACTG
CGCACCACTAAAATATCTTAAGTGGGTATACTGTACTATAGCTAGGTAATGGGGTTTATAGGTGT
page-top