Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig92
Contig Information
Length 1028 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14d16    rwhei14d16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_027848 [Oryza sativa (japonica cultivar-group)]
Score 770
Evalue 3.88718e-108
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig92
CTTCCGGAGGGAGCCGAGCCACCAGCGAGGTGGCCGTGTCCTCTCCCCAGTTCCAATGGCGCGCCGCCGCGTGCTCCTCTACCTCAAGCCCTTCGATGTC
TACCCTCCGCGCCCTCTCTCCGGCGCCTCCTCCCTCACCTTCCCGCCACCGCCTCCGCCGCCGCGCGCCGCCAACCCCAAGATCTTAAGTTATCTGGACC
ATAGATGCAGAGTCCACAAGGACACAATCAATCTCTGTAAGAGTGTACTACAGCGCAAGCCCCTTGACTGGATCTCAGTGCAGCGAAATCATTTGTCAAA
TCCAATACATGATGTGGATCTTGTGATTACTGTCGGTGGTGATGGCACACTTTTACGGGCTAGCCATTTTTTGGATAGCTCGATTCCCATTTTAGGTGTT
AATTCGGATCCTACGTGTTCTGATGAGGTTGAAGAGTTAACCGAGGAATTTGATGCGAGAAGAAGCACCGGATATCTTTGTGCAGCTACTGCCAGGAACT
TTGAGCAGATACTTGATGCAACCCTTGCTGGCAGTAGACACTATTCAGAGCTGTCAAGAATATCTGTGAAACTAAATGGATCCCAGCTACCAACTTATGC
TCTGAATGATATTGGTGTCACACCCCTGTCCGGCAAGTGTATCGCGGTTCTCATTAAGAAAAAGAAGCAATGGGGAGACCTCATGTTTGATTAATTCTAG
ATCAAGCGGTCTCAGGGTTGCAACAGCTACTGGATCAACTGCTGCCATGCTATCAGCAGGAGGATTTATGATGCCAATATCAAGTCGTGAGCTTCAGTAT
ATGATAAGGGAGCCCATTTCACCAACGGATGCCGACAAACCACTGCTGCATGGGTTAGTTAAGCAAGAGCAACATATGCTTGTTGTTTGGTACAATCAAG
AGGGTGCTGTGTATATTGATGGTTCTCATGTAACATATCCAATCCAGCATGGGGATACACTTGAGATCTCCTCAGATGCTCCAGTCTTAAAAGTTATTTT
ACCAGAATATCTGTTAAAGCAGGCATCT
page-top