Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig90
Contig Information
Length 610 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13a13    rwhei13a13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ATSK11 (Arabidopsis thaliana SHAGGY-related kinase 11); protein kinase >gi|27735207|sp|P43288|KSG1_ARATH RecName: Full=Shaggy-related protein kinase alpha; AltName: Full=ASK-alpha >gi|16226768|gb|AAL16257.1|AF428327_1 AT5g26750/F2P16_10 [Arabidopsis thaliana] >gi|15028149|gb|AAK76698.1| putative shaggy kinase alpha [Arabidopsis thaliana] >gi|23296760|gb|AAN13164.1| putative shaggy kinase alpha [Arabidopsis thaliana]
Score 711
Evalue 2.04079e-73
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig90
GGACAGCCTTTGTTTCCTGGTGAAAGTGGAGTTGATCAACTTGTTGAAATTATCAAGATTCTGGGCACTCCTACAAGGGAAGAAATCAAATGTATGAACC
CGAACTACACGGAATTTAAGTTTCCCCAAATCAAGGCCCATCCATGGCATAAGGTGTTCCACAGACGAATGCCGCCTGAAGCAGTGGACCTGGTCTCCAG
GCTTCTTCAGTACTCACCGCACCTTCGGTCCTCAGCTCTGGACGCTCTGATCCATCCGTTCTTCGACGAGCTCCGGGACCCAAACACCCGCCTCCCCAAC
GGCCGGTTCCTACCTCCCCTCTTCAACTTCAAGCCTCACGAGCTGAAGGGGCTTCCGATGGAGATCGCGGCGAAGCTGGTCCCCGAGCACGCGAGGAGCC
AGTGCCCCTTCCTAGGGCTGTAGGATCAGGCCTGCTGGCTACATGTGCGAAAAGGCGCTGTCTGCCATGCTAGCGAATAGCGCTCCTGCCTAGAGGAGGA
CTAGGCGTCGGAACAAGTGAACATGATCCATGTGGGTGGTGTCTGTACTGTTGCTTTGGACGGTTTGACGTGTGGTCTTGAACTGCCGGGACAAAGAGTC
GGAACGAGAA
page-top