Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig88
Contig Information
Length 722 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14d08    rwhei14d08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit probable light-induced protein [Triticum aestivum]
Score 585
Evalue 1.19297e-58
Total Hit Count 351
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig88
CCATCTGCCCTCTCGGCTCCCTCGGCTCCGGCGACCGCGACCTCGACCTCGACCGGCGACCGGCGACCGGCGGCGGGCGTCCCTCCCAGGTGTACAGGAC
AGTAATTAAGCAGGGTTGTGCAAAAGGACAGGAAAGTGCGCGTCCATTTGATTGAATGGCTTCAAAGATTCAAGCCTTCTTGAACCATCCCGCCGGCCCC
AAAACTATTCATTTTTGGGCTCCAACATTTAAATGGGGGATCAGCATTGCGAACATTGCCGACTTTGCTAAGCCTCCAGAAAAGATATCCTATCCTCAGC
AAATCGCTGTTGCCTGCACTGGAGTCGTCTGGTCACGCTACAGCATGGTTATCACACCGAAAAACTGGAACCTTTTCAGCGTTAACGTTGCGATGGCCGG
CACAGGCCTGTACCAGCTTTCCCGTAAAATAAGGCAAGACTACTTCTCTGATGATGGAAAGGAGGTGGCTGCTGCATCACTGGAAGGGTAGCGAGGACCG
ACTGGATTAATAATCGACTGCATAGCCTGCCTGCTGCCCCGGAACTCTGGGCCGCGGACCGGCTCAATTTCCGTGTCTTTCATTCTTTCCCATGTCGAAA
TTTCTTTGTCAGTCACGCCCTTGAACAAAGCAGAGTGGTATGAAAATTCCGCGCAGGTTAATAATCTTTGTGCATTTTGTGCAAAAAGGTGTACAGATTG
AACGCATACCACGCGGCCTGCT
page-top