Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig85
Contig Information
Length 743 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14c23    rwhei14c23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein CND02190 [Cryptococcus neoformans var. neoformans JEC21] >gi|134111092|ref|XP_775688.1| hypothetical protein CNBD4170 [Cryptococcus neoformans var. neoformans B-3501A] >gi|50258352|gb|EAL21041.1| hypothetical protein CNBD4170 [Cryptococcus neoformans var. neoformans B-3501A] >gi|57226897|gb|AAW43357.1| hypothetical protein CND02190 [Cryptococcus neoformans var. neoformans JEC21]
Score 93
Evalue 0.142667
Total Hit Count 31
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig85
CCTCTGTTGCAGGCCTCCTCTCCCTGTTGAGATCGGTACACACCGATTCGTCTCGCCAGTGCATGCTCCCGGCGGCGGATCCGGGCCCGCAATCGTCCCC
AGCGCGCCTCCCGTGTGCCTCACGCGGCGGATCCGGGCCGGCAACCGCCGCCCTAGTGCAGCTCGGTTGCGCCTCCATATGCAGCTCGATTTTGTCCTTG
TGGACACTGGCCACCGCGGCATCGGGGCGGAATCCCCCTCCTCTCTTCACTCTTCTCCATGGACGCGAGCCGATGAGCACCCCTCTGCCTCCCAACAACC
CCCCTGGCCGGCACCTCCATCCTCAGCCCGCGATGGTTATCAACAGTGAGCCGCCCCGACCCCCGACGGTGACCAGATCAAAAAGGGACGTCAGGTCCGT
CTGTATCATAGGGCGCCCTAGGCTGCCGCTTCACTGGCTGCGCACAGTCACCGTCTCCAGCGCGCGGTTCCAGCAGCAGGGGCCCGGGGAGCGCCTCTCT
CTCACCACCGTGGCATCTTGGAGACAGCGGCTTGCAGTTCGCCAAACAATTTTTGTGTATTTTTTCATATTATTGCTGTTGATTTGGGTGAACTCAGTTT
CTAATGAAGTTTGTTAAATCTCTCTATGTAGTTCGGCCGCCGCCGACATGAGGTTCACTTCGCCATGGTAGCCCCCAAAATCAACTCAGTTGTGTGCAGT
TCCCAGTTTTCAGATGGGTGCTACTACCTTCTGCACTACTTCT
page-top