Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig83
Contig Information
Length 413 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14c18    rwhei14c18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC_Os10g05420 [Oryza sativa (japonica cultivar-group)]
Score 86
Evalue 0.31696
Total Hit Count 55
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig83
CGCCATTCCACCTCCTCTTCTTCATCCAACCCGATCTAGCCCACGAACAGCTTGGCCTAGCCTTCCCACTGTGCGCAACCGTGGTGGCTGGCGGGGGCCA
GGGCAGCAACCCCCCCTGTCAGTGAGGAACCACGAGAGGACGCCATGGATGGCGCTTTGGAGCTGCGTCGCCCGATCTGGCCGCCAGCCCAGTATCTGAT
CCCCGTGCCGTGGTGGTGGAGCTCTCCGGTGGGTGGCTGGGCGACAGGGGATGCGGGGCCGCCTCGGTTGCTCGCCAGATCGGCAGGCCTGTGTGTGCAC
TGCGGCTGCCAATGGTATCAATGTTTTTCTGTATTCTCTCAGCTCTGTTTCCATGAGGATTATTATTANAAGGAATGTCAAATTCGCCGCCGCGACCACT
GCTTTTTGTTGAA
page-top