Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig81
Contig Information
Length 770 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13b24    rwhei13b24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0563600 [Oryza sativa (japonica cultivar-group)] >gi|77556167|gb|ABA98963.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113649545|dbj|BAF30057.1| Os12g0563600 [Oryza sativa (japonica cultivar-group)]
Score 628
Evalue 1.3946e-63
Total Hit Count 185
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig81
AGCAAGCGAAGCTCGTGCGTGAGCGAGCGACCGAGCGAGCTGAAAAACCACCCTACAAAGCTCCGGCTGAGCCACCCGTCCGGCCGGCGACGATGCCGAT
GCTCATCCCCGACGACGTTCGCGCCAAGGCGGAGATCTACACCGGCGACGCGGCGGGGCAGGAGAAGACGCGGCTGATGCTGGCGGAGACGGAGCTCCCC
AGCGGCCTCCTGCCGCTCAAGGACATCATCGAGTGCGGGTACGTGGAGGAGACCGGCTTCGTGTGGCTCAAGCAGAAGAAGCGGGTGGACCACTACTTCG
CCAAGGCCGGCCGCCACGTCTCCTACGCCACCGAGGTCTCCGCCATCGCCGAGAAGGGCCGCCTGAAGAAGATCTCCGGCGTCAAGGCCAAGGAGATGCT
CATCTGGGTCAACCTCCACGAGATCTGCGTCGACGACCCGCCCACCGGCAAGCTCCACTGCAAGGCCATCGGCGGCCTCTCCCGCAGCTTCCCCGTGGAG
GCATTCGAGGCCACTGACGCCCTGGCCGTGCCCGTCACCGGACGTCTCAAGAAGAAGACAGAGAAAGAGAGCACCGACAAGAAAGACGAGAAGGAGGAGG
ATTCAGCAGAGAAGCCGAAGGAGGAGGCAGCAGAGAAGCCCAAGGGGGCCGCCGTCGCCCCCGCCCCCGCCGCCGTCGATGAGATCGGTCAGAAAATGAA
GGAGATGAACACGGAGGCACCCGTGCAGGCGGAAGCGGTGGCAGCCAAGAACTGATCGGTGGCGGCGACG
page-top