Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig78
Contig Information
Length 451 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14c09    rwhei14c09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit TOM7-like protein [Triticum aestivum]
Score 308
Evalue 5.81378e-27
Total Hit Count 61
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig78
CCAAAGGCCACGTCTCTAGGGTTTTCGTCCAGCGAATCGAAGAATCAAGAGGAGTCGCCATGGCGTCGCGGCCGTCGCTGAAGCCGAAGCCGAAGGGCAA
GGGTGGGAAGAGGGGCTCGTCCGCGGCCGAGGACGAGCAGTCCACGGCGGCGGTGGCGGTGCAGCTCGCCAAGGAGTGGAGCACGTGGACGATGAAGACG
GCGAAGGTGGTGGCGCACTGGGGCTTCATCCCGCTCATCATCGTCGTCGGCATGACTAAGGGAGACGAGCCCAAACCTAGCTTGTTCCAGCTTCTGTCCC
CCGTCTGATCCCATCCCCGGCGAGCCCTAGACTGGATCGATCCAGCTCCTTTTAGTTACTACTAGTAGATGTTTTTGCTGTTTATTGAATCCTGGTGGTT
GAGTTCTTGATCCCTGGGTGGTGATCTTCTATCTGATCTGTGTCGAATAAT
page-top