Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig77
Contig Information
Length 319 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14a24    rwhei14a24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100194331 [Zea mays] >gi|194695542|gb|ACF81855.1| unknown [Zea mays] >gi|195624594|gb|ACG34127.1| ras-related protein RIC2 [Zea mays] >gi|195643338|gb|ACG41137.1| ras-related protein RIC2 [Zea mays]
Score 172
Evalue 3.45879e-11
Total Hit Count 66
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig77
GGGCGGTCGAGGCGGGTGAAGACTCGGCCGCTGGCCCTGGCAAGGGTGAGAAGATCAACATGAAGGACGATGTCTCGGCGGTGAAGAAGGGCGGGTGCTG
CTCTAGCTGAGGCGCCATGCTGTATTTTTTGTTGCTGAGCTTTTGTGACGTGGCCTTTGCAGCGACCGGGAATTATTAGTAGCAGTAGTAGCAAGTATTA
TTATTATGATGATGATGTTACCTAGAGAAGTTGAAGTTTGTTGCTGAACCGAGAAGTTTGTCTAGATGAGGTGAGACCTTCCTTCATATTGTTGTATCGT
CTTTGCGGCAAAAAAAAAA
page-top