Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig76
Contig Information
Length 508 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14c04    rwhei14c04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_07001 [Oryza sativa Indica Group]
Score 263
Evalue 1.0783e-21
Total Hit Count 63
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig76
CGGCGGCCCGAATGTCCGCTTCTGCGCGGTTGGAGACGGCCCCGAGGAGCGCAGCGCAGCTTCCATAATGAAATGGCCGTTCGTCAAGATCGAGATCCGC
CCAGATGCTCCTCACAGGTTCCCCGGCCTGAGCCTGTCAACGATCCACGGCATCATGGATGCTGTGTACCAGTCATCGGGCAAAGACGGTTGACTTCTGA
TGCCCGCGGTGTAGATGTCTTGAGGCATCGATCGCCAAAAGGAGGAGGCCAGTGAGGTGATAGTTCAATGGAACCGCATAGTGGAGATACCATATATATA
GGAGGCATATTGCCCTCCCTGCCTGGAGGATCCGGAGACGCCTGTGAGATAAATAAAGAGCGCCCCACCATATAGTTTGATCCGTTCCGGCATGTTTGAA
TCGAATTCTGCCAGTGTTGGCCCATCTTTACTGTCATCTTGGGAATCATCTGCTGTTGTAAGTCGTAACTGGTTGGTTGGTTGTTGTCGAAAGTCTGTAA
AAAAAAAA
page-top