Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig74
Contig Information
Length 303 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13c08    rwhei13c08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutathione transferase F4 [Triticum aestivum] (no hit)
Score 1018
Evalue 8.68026e-109
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig74
CCAACATGGTCTTCGTGGTGGGCATGGAGGAGTAGAGGACGATGGCGGTGGGGGTGGGAGCAGAGTAGCATGAACTTCCAGGCGGCGCTCGCGTCATGGT
GGAGTGGAGGAGCTCGTCATCCATCATCACCATCCCCAATCTAGATCTGTGATAGAAAAGAAGAGAAAGAATCTTGTGGAATTTCATATCTGAGATAGGA
ACGGGGAGAAAGAATCTTGTGAAAGAGCATGACGAAAAAGAAAGGGGTGAATCATCACTTTCTCCCATTCATGTTTGTTTCCGCATTTTAATTTTTAAGA
TGC
page-top