Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig73
Contig Information
Length 785 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13n17    rwhei13n17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutathione transferase F4 [Triticum aestivum]
Score 1018
Evalue 8.68026e-109
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig73
TGTCGCCGTGGATGGCGCGGGTCCTCGTGTGCCTGGAGGAGGCCGGCGCCGAGTACGATTTCGTGCCCATGAGCAGGAACGGCGGCGACCACCGGCTGCC
GGAGCACCTCGCCAGAAACCCCTTCGGCGAGATCCCGGTGCTGGAGGACGGCGATCTGACGCTCTACCAATCCCGTGCCATCGCAAGGCATATTCTGCGC
AAATGCAAGCCCGAGTTTCTAGGAGCGGGCAGCCTCAAGGAGTCGGCGATGGTGGACGTATGGGTCGACGTGGATGCCCACCAGCTTGAGCCCGTACTCA
AGCCCATCGTGTTTAACTGCATCATCAACCCGTTCGTCGGGAGGGACGTCGACCAAGGCCTCGTCGATGAGAGCGTCGAGAAGCTCAAGAAGCTGCTGGA
GGTGTATGAGGCGAGGCTGTCAAGCAACAAGTACTTGGCCGGTGATTTCGTCAGCTTCGCCGACCTCACCCATTTCTCCTTCATGCGCTATTTCATGGCG
ACGGAGCATGCGGTTGTGCTCGATGTGTATCCGCACGTAAAGGCATGGTGGGAGGCGCTGCTGGCAAGGCCGTCGGTCAAGAAGGTGATAGCTGGCATGC
CTCCGGACTTTGGATTCGGGAGCGGGAACATACCATGATAAGGCATATGCTTTGTGTGCTTGTGATGCTCTAATCATCTCTACCCAACCCACGAGCAATA
AAGTAAGCAAAGTGTGGGTGTGGGTATGAAATAACTTGTTTCGGTGAATTGTTTCCTAATACCAATTAGAATGATTCTCAAAAAA
page-top