Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig70
Contig Information
Length 253 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13d20    rwhei13d20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit plasma membrane associated protein [Hordeum vulgare]
Score 149
Evalue 1.61176e-08
Total Hit Count 46
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig70
CGGTGGCAACCATGCTGGTGGGTATCCGGCGGAGCATGCGTACGGCGCAGGCGGCGACCCGCACAACAAGGGCATGGGCACCGGCGGCGTCGCCAGGGTC
TGAGCTGGTGATCGATCTTGTATGCATACATGGTATTGGTGTGTGTTGTGTTCATGGTTGTAGACATGTAGCATGTACTAGTGGGTGTGTTCCGCTGCCT
CCCGGCACGGATGGAGTTTAATTTACTAGTAGTATGATCGATCAAAAAAAAAA
page-top