Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig69
Contig Information
Length 469 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13e02    rwhei13e02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_034384 [Oryza sativa (japonica cultivar-group)]
Score 204
Evalue 6.67056e-15
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig69
CTCTGATCGATTACTTAGGGCATACACCAGACCAGTGGAGGTTACTGCTGCGGATCAACAAGAGTCAAGGTGGTTTATATCCAAGGATGCAGTTGTGTCA
GGCCTTGGTCTTCTTGGCATCAAGCAGGGTGGGCCTGAGGCACAGCTGTCCAAGCCCCGGCGAAAGAGAGTAATCCGCAAGAAAGTTGCATCAGGTTGAA
ATTAGTGGATTTGCTTGCGGTGCTGGAACAATTTTGCTTCAGTTCCACTCCTACCGTACTGAGAGTCATACCAGGTGTGAGCAGTGAGGAAAGCCATCAT
TGGGAATCAGAGGCCAGTTTACCGGCCAAGGCATCGAAGTGGGGTGGTTGAGAGCTTCGCGCCGTTTGCCATTTTGTATGTTTTGTTGATTTCTGATAAT
AATTGACATCTCAATTTCTCGCAATTTTCTGAGCCAAATTAGGCACACTTAGGTAGGCTGAGAATGACA
page-top