Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig67
Contig Information
Length 584 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14b03    rwhei14b03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0373000 [Oryza sativa (japonica cultivar-group)] >gi|49387802|dbj|BAD26367.1| brain protein 44-like [Oryza sativa Japonica Group] >gi|113631262|dbj|BAF24943.1| Os09g0373000 [Oryza sativa (japonica cultivar-group)] >gi|215765123|dbj|BAG86820.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218202048|gb|EEC84475.1| hypothetical protein OsI_31133 [Oryza sativa Indica Group]
Score 524
Evalue 8.673e-52
Total Hit Count 357
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig67
CTCCCTCTCCGACACGCCGCCGTCGATACATCCACCCGAGGCATGGCGACGGCGTTCAAGGCGTTCGTGAACAGCCCCGTCGGCCCCAAGACCACCCACT
TCTGGGGCCCCGTCGCTAACTGGGGCTTCGTCCTCGCGGGTTTGGTTGACTTGAACAAGCCTCCTGAGATGATATCTGGCAATATGACAGCCGCCATGTG
TGTGTATTCTGGGCTCTTTATGAGGTTCGCGTGGATGGTACAGCCCCGGAACTACTTGCTCCTGGCATGCCATGCCTCCAACGAAACCGTTCAGCTCTAT
CATTTATCTCGCTGTGCTAGGGCTCAGGGGTATCTGGATTCCAAGAAAGAGCCGGAGGCCCAACAGTAAAGGGTGTGGTGTTTCTGAAGTCGGAGGAGCC
TTGACTCCGCAGCCAGCCTTTCAATAAGTAAAATTTGTTTCTGAAGCTTTGCAATGCCCTTCATGAGAAAAAACCTATACAGTGGAAATTTCTATTTCTA
TGATACTCATGCCTGCAATGTGGCATTACAGCTTTCTTGTTCCTGAATCATGGTACGTGACATATTTTTTCCTTGTCAATGCAC
page-top