Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig66
Contig Information
Length 378 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14b01    rwhei14b01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_15709 [Oryza sativa Indica Group]
Score 157
Evalue 1.8827e-09
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig66
CTTATGCGAGGATCCCCTCTCGGAGGTCGACCTCAACAACATCCTGCCCTCTCGGACCCGCCGCTGCGCCCCAGCACAGCCTGGGGCGTACCTGGTGCCA
CCAGAGGAGGCAGCGGAGGATGACGAGGACGATGAGGACGCAGACGTCGACATGGCTCCCGGGGAGGAGAGCGGCGACGGGGAGGAGAGCGATTAGGGTC
GCAGCTGGACTAACTCGCTAGGCAATCCCTTCGTCTCGCGCTTGTGATGCACAGAAATGTTTCTATGGACTGTACCCTTGTGGAAGTACATTTCTGCGAT
TGCATCCAGTTTAGGCCTTTAGGTACCGAATTTATGCATCATGAGCGTTTAATTTCGCAGGTATGACCTAATTTAAGT
page-top