Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig65
Contig Information
Length 687 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13n11    rwhei13n11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cytoplasmic protein [Syntrophus aciditrophicus SB] >gi|85722568|gb|ABC77511.1| hypothetical cytosolic protein [Syntrophus aciditrophicus SB]
Score 82
Evalue 2.28373
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig65
TTCCTTCCTTCCGGCGGCCCTGGTGGCCGGCAGGAGGATGGTGTAGGTGGTCGTGCTCTTCTTGTACATATTAGGTCTAGGTTTAGTTCATGTCTTCGGC
TATATGCTAGTCTTTGGCTACATGCCGGTCATCGGCTCTATGTCGGGAGGGAGATGCCAGGTCTAGGGGCCCGGATCTGGTATTGCTTTGTCTCTCTGCT
CCTTGTTGCGGCGCTCCCATGGACGGAGCCAGAGGTGATGAGGAGGAGAGCACCTGAAACCTCCAATAATAAAAAGGTTGTTGTGGTGGAGCTTGGGTTC
TGGGTGCCTCTCCGCGATCTCGTCGTCGCGGTGGCGGAAGATGGAGAGGGGTGGTCGAATATGAGTTGGAGATCACCACATGACAGCCACGATCTGCCGC
CATGACCTTTGGCTGAGAAGGCGGCCTTTCCAGACGCCTTTGAGAGCGTCATCTCAACCTCCTCCAAGACGGAGGCCCTCTGTGGGATTCCCAGCGGCGC
GCAGCGGCCTTCCTCTCCCATGTGGTTTCGTCCCCGGCGAGAAGGAGGACGGTCGGCGGTGGAGTCCCTGTTGTTGTGGTGGAGAAGGACTTGATTGCTT
TTCGATGTTACTTTTTAGGGTCCTTTGTGTTAATTTCCAGGACTGTTGTGTAACTTCTAGTTCTTTCGGGATCCCTGTTTGTGTATT
page-top