Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig64
Contig Information
Length 492 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14a21    rwhei14a21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit oxidoreductase, 2OG-Fe oxygenase family protein [Zea mays]
Score 280
Evalue 1.02581e-23
Total Hit Count 34
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig64
CGCGCCGGCGAGGCCAATGGTGATGGCGCCCTCCAGCAACATCAACAAGAGGATGGGGCGCGGAGGCACCGGCGTGTTCCTGCCGTGGACGGTTGGGCCC
AAGAGGTACAACAAGCACCTCCCCCCGCGCATCCAGAAGCGCCGGTTCTCGGCGATGATGTCGCCCATAGAGTCGCAGGGCTGAAACGGCCGGACCGCAC
CTCACCTCGCCGCCGGCATAGCCGTTGGATCTGATCGATAGGCCGTCGTACATCCCCGGTTGGTTCGTGGAGCAGTTTTTCTTCTTCCGAGGCAAAAAGT
TCGGAAAACGCACGGGCAGCGTGCCCTCCCTCCCTCCCTGTGTATTCTGTTTGGTGACTCTCGTTGGTGCTGGTGTTTCTTTTTTTCCTTGTTGTGGGGT
TTGGTCTGGTCTGCCTGTAATCTAGTTGAGTTTGTGGCCTTGTGGGTAGCACAGGGCCGATGCGGTACGTAGAAATATGATGATGATGAGTA
page-top