Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig61
Contig Information
Length 739 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14a12    rwhei14a12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Aspergillus terreus NIH2624] >gi|114194518|gb|EAU36218.1| predicted protein [Aspergillus terreus NIH2624]
Score 83
Evalue 2.04234
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig61
AAGATTTCTATTCACCAAAAAGATAGAGCCGCCATCAGCAAGCACTGACGAGTAGCACAGTCTCAGCCGATGCATCGACGAGCTGAGGCGGGCTTCCAAT
AGAGATCAGAAACAAGGAATGGCCTTTTGAGCTGGTAGAGGGATCACTAGACGTGGTGTTCATGTTTGTGTTGGCTTACATGCAGAAATAAGGAGGATAG
TAAGACTCTTGGAGGTCATGTCTCTGCCATTCAAGGATTTCGATATCTGAATGTTATGACAATATATAGATAAGGGAGATAGCCCTCCGCGTCCTGGTGG
CTACTGTATGCTGCAGCGAAGGGCACACTTCAATTACTGTGCAGGCAGATGCGGTGATCCCGGGTGTGCTTTGAATAGATATCAAGGACGTCATTACCCG
AGCCGTTCCTATGATTGAACATGCGACCAAGGAATGAAAACTCTTCTCCAGAGATCTTCAAAATAGTACAATATCAGATACACATGCCTGAATCTGGATA
CACTCCACTGCTGATGGTAATACTTTCCAGTCACTCACAAACAATAAGCTTCGGCATACAAGGCAGAGTCCAATGCTATTGGATTGGGGTGCTGTCTGAG
CTACCACTTGGTGAAGATGGGATTCAATATGTTCAGTGATACCCTTTTTTGTGTGTAGGGAATCACTGATATGATACAACTATTTGTTATCTGAATTTTC
GAATATATGTACACCCATGGTGACGTTTCAATGCTCATT
page-top