Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig60
Contig Information
Length 624 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14a05    rwhei14a05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=RuBisCO large subunit-binding protein subunit beta, chloroplastic; AltName: Full=60 kDa chaperonin subunit beta; AltName: Full=CPN-60 beta >gi|1167858|emb|CAA93139.1| chaperonin [Secale cereale]
Score 684
Evalue 2.89187e-70
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig60
GCTCTAAACGCAACCAAGGCTGCTGTTGAGGAAGGTATTGTTGTTGGTGGAGGGTGCACTCTTTTGAGGCTGGCTGCTAAGGTTGATGCCATCAAGGACA
CCCTCGATAACGACGAGCAGAAGGTTGGAGCTGAGATAGTGAGGAGGGCGCTGTGCTACCCACTCAAGTTGATCGCCAAGAATGCCGGTGTCAATGGCAG
TGTTGTCACCGAGAAGGTTCTTTCTAACGACAACTTCAAGTTTGGCTACAACGCTGCCACTGGGCAGTACGAGGACTTGATGGCTGCTGGTATCATCGAC
CCCACTAAGGTGGTGAGATGTTGCCTGGAGCATGCTGCGTCGGTGGCCAAGACCTTCCTGACGTCAGACGTGGTGGTCGTCGAGATCAAGGAGCCCGAGG
CCGCGCCCCTCGCCAACCCCATGGACAACTCTGGCTTCGGATACTGATGAGCGACATGGCCGAGTTTCTCCGAAGGATGTGGTTTAATTTTTGGTAGCAT
GAACCAAGTTTTGAGAGATTGATGATGATGATGTAGTTTCGAGACAAGGAAGAAAAAAAATGCAATGCGATGTGCCGCCAGAAAGGCGAAATAAGCAGAG
AAACATTTAGCGGAAATTTCTTGA
page-top