Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig59
Contig Information
Length 508 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13e23    rwhei13e23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PPE family protein [Mycobacterium tuberculosis H37Rv] >gi|148660071|ref|YP_001281594.1| PPE family protein [Mycobacterium tuberculosis H37Ra] >gi|167967606|ref|ZP_02549883.1| PPE family protein [Mycobacterium tuberculosis H37Ra] >gi|7478716|pir||B70524 probable PPE protein - Mycobacterium tuberculosis (strain H37RV) >gi|38490171|emb|CAE55270.1| PPE FAMILY PROTEIN [Mycobacterium tuberculosis H37Rv] >gi|148504223|gb|ABQ72032.1| PPE family protein [Mycobacterium tuberculosis H37Ra]
Score 91
Evalue 0.0949032
Total Hit Count 29
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig59
CGACGGCGAAGCCGAAGCCGAAGCAGCCAAAGTCGATCCGCGGCAGGAAGGCCAACAAGGCCAGCGCCTGATGCGGCGGCCGCCGGCGACGCCGTGTCCC
CTGTACATATCTCGGTAGTGGACATATCTCGGTAGTGGACAGTAGTGTCCCCTGGCACGTTCGATCCGTGTGTGCGTGCGTTGCCGGCAATAATGGCGCC
GTGACTGTGTTCCGGTGTCGATCCGAGGAAGGAGAAGACGGTGGATGTGGCTGTGAGACTGATGCTTGTACCACTCGTCTCTGTGTTGTCATCCTGCTCT
GCTCCTCCCCTCTGCGGTTTCTGGCTTCGATTTGTATCGCTGGCTTAGGTAGATGGTGCACTTTGGGAGATGAAAGTTCTAGATATGCCACTCTGTTCTC
GCACGTAAAAATCATAGATATCAAGGCCCTTGATATGATGGCTCTCTTACTCGCTCGCTCCGGGAAGCAAGCCATCCAACGCAAAATTTTCTAAAACCAA
AAAAAAAA
page-top