Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig57
Contig Information
Length 516 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei14a01    rwhei14a01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 5-oxoprolinase [Roseovarius sp. 217] >gi|85669637|gb|EAQ24502.1| 5-oxoprolinase [Roseovarius sp. 217]
Score 77
Evalue 4.16849
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig57
AAAAAGTTTGCGGCGGCTGCGCTGTTCTTCCCAGCAGCGCCGACTGCTGCTTTCGTTGGAAGCCAGATTCGGTTGCGGGGGAGATGGAAAGGCGTCCTGC
GACGAGGGGCCTCTGCACGCCGCCGCCTTTGCGACCACCATGACATCTCAGTCTCACTCTCACACGGTTCCAGCAGCCGGGGCAAGCACATCGCCAGGAG
AAGCTCGCATGCTGGACCAGGAACTTCTGCTATTAATCCACTTAAAAGGAAGAGGGGTGTCTATGGTAAGAAGAAGAAGATGATCCCTGTTACTCCTCAA
GAAGATCTGCTCTTTGCTTCCTCTGCTTCAGAAAGTGACGACGACGAGGACACCGACATGAGTTCTGGTTCTGACATGTGAGCTTGTCGGTTTCTCTATG
AAGTTCGTTTTGGCGCTCATGATTCTATCCTTTCCTGTGTGCTTTTGACAAATGAATTGTGAAGACTTTGTGATGCATGTAATGGACTATGGACATGTTG
CTGTTGTTAAAANAAA
page-top