Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig56
Contig Information
Length 809 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13f10    rwhei13f10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100193167 [Zea mays] >gi|194692562|gb|ACF80365.1| unknown [Zea mays]
Score 277
Evalue 7.64348e-23
Total Hit Count 14
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig56
CATCGTATCTATCTGGAGCACTTGAGCCTGTGCAAGCATCACAAATGTTTGCAGCACTTGGTGTTAGTGGGAGAAATGTGGCGGCACCAAGCTCTGGGGC
AGTAGCGCCACCTGTAAACCAAAGTTCAGGAGCTCATCATTCATTCGATCCGATGAATTCTCCTCAACAAAATCAACCACAGCCTCTTGTGTTACCAAGC
TGTCCTAAAACAACCATTCCAGAGCCTCCGTTTCACTTGGAGTCGTCACAGCCCCACCTTCAATCATTTCAGTTGCCTGAATCCTCCGAGATGATGTTGC
GAGGGGATATAATGCTGAAGCATCACCTAACATCAGCTCAGGACAGAGCTGATCCATCAGGAAACAAGATGAACTCATTAAGGCAAGAATCATCCATGTT
GAACACTCATTTTGATGGATGCTCGCGTAGCAAAGAGCAGTCACATGATATGGTACCAGCAAATACACGGCATGTGTAGCTTAGGAAGTGATCACCAGTG
ACACCGAAGAAGTCGGCGTGCGAAGGCAGGATGACGTGACGTAGCTCAGCGATCTAGCTACTAACCGGCAAGTCCGACAGTCAAAGCTTTGCCAATCACT
GACTGATCTCTCCGTTACCGCTATATAGTTCTACTGTTAGTTCTTGAAGCGGCCTGAGCGCTTCATCTTCACTTGGTAGTACTAGTAGCTAGAGAGAAGA
ACCCTGTAAAATATTGCTCATCTGATGCTCCTTTTTTCCAGTCAATTTGAGGGCCTCAGGACTAGCAGGTAACTAGACTAGTCTGCCATAATATGTTCTA
TGATGATGA
page-top