Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig55
Contig Information
Length 763 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13f14    rwhei13f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38785 [Oryza sativa Indica Group]
Score 368
Evalue 1.93246e-33
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig55
CTCTTCTTCCTCGACTCCCTGGTCATAGCACCACACAGCTAGCTAGCTAACAATGGCGGCCTCGAAGCCCCTCGCCCTCCTGCTGCTCGTGGCTCTGTCC
GCAACGGCCATGTCTGCCGCCGGTCAAGGCTGCGGCGGCCACAAGGTGACGGTGCAGAACCTGTGCGGCCACGACCTGAACCTGGGTATCGCGGCGGTGG
CGGACAGCAAGGTCCTCTTCCCCAACGGCTGGCTGCTCCCCAACGGGAAGCACGAGTCGTTCGACGTGTGCTCGTGGTCCGGGAGCGTGTCGGCGCAGGG
CGCCGCCGTGGCCAAGTTCCACCTGGGCCACGACGGCGGGGCGTACTACGAGGTGAGCACCGACCAGGCCAACATGCCCATCCGCGTCTCCGTCACCCCG
CACGGGAGCCCGCTGCAGGGGCACTGCCCCACCGCCGGATGCAACAGCGGCAACCACTGCTTCGAGCACTCCGTCCCCGGCGGCAACTGCCACGGCGTCA
CCGAGATCAAGATCGTCTACTACAACCCATAGATCGATCCATCCATCGCCCGTCTAGCTAGCTGCCGCACCTGCTTAGTAGTGTTGAATAATGTTGCAGC
TGTTTCAGGTTAATCTGTTGTGTGTTCCAACGAGGTGCCAGTAGATTGTACCGTCGTCAGTCGTGTGTACTAGTGTCGGATTTGCAGTTTAACTAGCTGT
GTTTGCATGGATGTAGTATGAGCTTAGCTCAAATGCAAATGTTTGCGTGTCGTGATTGTGTCC
page-top